While 99.9% of all DNA in humans is the same from one person to the next, there is approximately 0.1% that is different. It is a portion of this 0.1% of DNA that is examined in routine autosomal STR testing. Due to the fact that this 0.1% of DNA does not have a known function in the human body, it is highly variable from person to person.

The areas which are examined are called STR’s which are Short Tandem Repeats. These STR’s are short sequences of DNA that are repeated a number of times (6-40 times) in a particular location on the DNA. For example, an STR might look like this:

ACGTACGTACGTACGTACGTACGTACGTACGT

These repeats of core DNA sequences (2-7 bases in length) can be thought of as boxcars on a train. Different individuals can have a different number of repeats at the same location. Many STR’s occur on each chromosome; only a subset has been developed for identity testing purposes.